Taoffi's blog

prisonniers du temps

Meta models… what is it and how can it be useful (for you)

 

I spent a long time during the last months writing about meta-models. That was in the context of a book for Editions ENI (France) about some concepts to which I dedicated some work since quite a while (it was around 1998, as long as I remember, that I started studying the basis of the approach).

 

In previous posts (see, for instance, Silverlight database to DataGrid, yet another approach- Part II) I exposed a generic approach for describing database meta-data. The direct practical purpose of those posts was reading and displaying data into Silverlight DataGrid. Through this exercise, we also saw how can our structures help us in integrating business rules at several level (meta-column, meta-table… and so on).

 

In this same exercise, applying the meta-models approach would consist of persisting these structures into the database… to read and create them dynamically.

 

We would, for instance, store our meta-columns / meta-tables definitions into the database and let our software objects load these structures and transform them into ‘live’ data, integrating all defined business and technical constraints.

 

 

 

What are meta-models?

 

I use the term "meta-model" to designate "a description of a description" stored in a database and interpreted (read and presented) by one or more (specific) software objects (classes).

 

That is: the information stored in the database describes an object or a behavior, and the software class that reads this information is aware of the fundamental semantics of this information and is, thus, able to interpret it independently of a particular context.

 

This means that, according to our view, a meta-model is composed of:

 

§  Database objects and structures to store the model's data;

 

§  Software (kernel) objects that know the fundamental semantics of the database model.

 

 

 

The collaborative aspect between the 'description' stored in the database and the 'runtime object' (which reads and interprets that description) is essential for this approach to be applicable.

 

 

 

Why use meta-models?

 

Let us take a sample application where the software should display a page (or form) composed of a Master / Detail connected regions… i.e. a list of items in a Master grid, with a Detail form that displays the details of the item selected in the Master grid.

 

That 'Master/Detail’ layout may be the software application's approach for presenting the information of several entities. The application developer may choose to create a specific page for each manipulated entity… a choice which may be correct in some contexts, but which also remains questionable by its repetitive approach.

 

 

 

In another, more automated, approach, the software developer may prepare templates for each entity's specific Master/Detail information, and load the required template according to the context's entity.

 

This latest approach would be a first step for a meta-modeling approach for entities' presentation.

 

 

 

In fact, storing these templates as part of software objects would make them dependent of their related objects' compiled state. That is: the template cannot evolve without changing and recompiling related objects' code. Storing template's information in a database (meta-model) would circumvent this inconvenience.

 

In the same time, storing templates' information in a database would also require a (more or less important) change in software object's structure and behavior. Using a database meta-model approach (to describe Master/Detail templates in our case), requires the software object to act in a more abstract way. And this is what we called 'collaborative' approach (between database meta-model and runtime objects).

 

 

 

Finally, in the long run, our software object would constitute a 'kernel object' capable of displaying and handling any entity's Master/Detail information stored in a database meta-model.

 

 

 

What can we do with meta-models?

 

The sample exposed above can of course be extended to more elaborate models and interactions between descriptions stored in a database and their software objects' counterpart.

 

Let us again take another practical sample: an application that may need to normalize the appearance of asp.net data grid controls.

 

We know that a GridView control contains some appearance properties like:

 

§  Width;

 

§  HeaderStyle-CssClass;

 

§  AlternatingRowStyle-BackColor;

 

§  … etc.

 

 

 

We may choose to use the database to store values for each of these properties and let our software objects assign these values to each DataGrid (on the page's load event for instance).

 

Now, to handle the appearance of our GridView controls, we just need to assign new values for these properties in the database. A task which requires less effort, less time and fewer technical skills.

 

 

 

Meta-models and Reflection

 

Reflection is the process of introspection (self-examining) of the internal structures of software objects at runtime. .NET implements Reflection in some classes defined in the System.Reflection namespace.

 

 

 

Our previous exercise can be extended to more abstract and useful applications.

 

In fact, a software object (like GridView in the last sample) has properties to which we can dynamically assign values if we may simply know their name:

 

 

 

 

PropertyInfo property = Type.GetProperties().FirstOrDefault(

                            p => string.Compare( p.Name, my_name) == 0);

 

 

 

 

After locating the property inside the specified object's Type (class) we may assign it a specified value:

 

 

 

 

property.SetValue( … )

 

 

 

 

Our meta-model may make use of Reflection mechanisms to store property names and values in the database, to read and assign the specified values to the specified objects at runtime.

 

 

 

This approach may be of interest in many software applications. Its main advantages are, again:

 

§  More adaptable and versatile software;

 

§  Reducing development and maintenance efforts, time and cost!

 

 

 

Meta-models and method invocation

 

What we explained above about using System.Reflection to discover an object's property by name and assign a value to the retrieved property, is also applicable to methods:

 

 

 

 

MethodInfo method = Type.GetMethods().FirstOrDefault(

                            m => string.Compare( m.Name, my_name) == 0);

 

method.Invoke( … )

 

 

 

 

On the other side, user interface’s command elements like Menus, buttons… are often associated with an event handler that represents the entry point for the action of the command.

 

 

 

To explain how a meta-model can be useful in this area, let us take an example of an update button.

 

An update button collects the user entries into the form fields, checks their integrity and submits them to the server for updating the specified table;

 

Having the meta-data and business rule constraints for the columns of the entity, this update operation can be handled through one same handler. Or be handled by a dynamically selected handler specific to the context.

 

So, we know that a data entry form would have an update button. And we may need to assign a specific method as the handler of the Click event for this button.

 

All these required information elements can be stored into a database meta-model. The meta-model software would then:

 

§  Read (or otherwise find) the name of the method assigned as handler of the button's action event;

 

§  Dynamically locate the method in the software (loading the assembly when required);

 

§  Invoke the method.

 

 

 

Again, this meta-model solution can be applied on different contexts (records submission, web service operations invocation… etc.) and/or on different objects or controls (buttons, menus… etc.).

 

 

 

Interoperability and Integration

 

The database meta-model approach may also be used in a way similar to what we already use in Interop assemblies (which create links between 'unmanaged / native' code end 'managed code').

 

A meta-model-aware assembly method may, for instance, prepare entries to methods that reside in non-meta-model-aware assemblies or methods.

 

Such methods can also be defined in different projects independent of the 'meta-model-kernel' assembly. And may, thus, allow a high level integration of existing applications (or data) into the meta-model solution.

 

 

 

Extensibility

 

As we said above, the meta-model as exposed in this paper, is a collaborative ensemble where the database descriptions are tightly connected to the meta-model kernel software.

 

Two more questions though:

 

§  What about the evolution of the meta-model's own kernel?

 

§  How to describe objects that we don't yet know about?

 

 

 

Here comes another important point which seems to represent a good basis for answering the above questions:

 

§  An object is represented by a set of properties;

 

§  A property is, essentially, a definition composed of

 

·         A Name

 

·         And an Attribute (the Attribute defines property's constraints: mainly 'Data Type');

 

§  A Value can be assigned to a property in the context of either a class (static property) or to an instance of this class. (Note: Value should conform to the attribute's constraints).

 

 

 

So we may consider the data of an object as a collection of (Property / Value)… i.e. a collection of ((Name/attribute)/Value).

 

This seems to be, more or less easily, presented in a meta-model, which may allow us to handle future 'unknown objects' or future unknown 'properties'.

 

 

 

Meta-models self-describing

 

On one hand, meta-models are data stored in a database… and on the other, they are extensible. Managing them can also be described by meta-models. This recursive aspect can be of interest to some applications to allow users to autonomously manage software semantic behaviors without the need of extensive technical knowledge.

 

Learning from Nature: Towards a Nucleotidic modeling - part II

Two days ago, my friend Olivier Vallée sent me an article (nytimes) talking about the emerging role of software tools in reducing costs of lawyers’ work by analyzing documents contents. This reminded me the work we did, Olivier and I, some years ago around the use of a nucleotidic approach for analyzing textual data.

 

So, here again to continue the subject of the earlier post!

 

In part I, I presented a first view of the analogies between molecular biology elements and other real world problematic. And a probable benefit of using molecular biology’s structures and be behaviors to in data modeling and software solutions architecture.

In this part, I will try to expose a simple and direct application of this approach: language modeling and analysis. There are several advantages for starting with textual analysis as a first application:

·         First, a textual object structure can easily, and somehow directly, be mapped to molecular biology elements (nucleotides, DNA strands, amino acids…);

·         Second, the textual analysis is becoming (re-becoming!) a must know (and probably lucrative as well J) technology  (see nytimes article);

Let us first try to analyze the physical (organic) structure of a textual object:

·         Characters;

·         Composing Words;

·         Composing phrases;

·         Composing paragraphs;

·         … etc;

 

This same physical structure can be interpreted according to other (different / parallel) logical  components:

·         Symbols (óCharacters);

·         Composing phonemes (ówords);

·         Composing expressions;

·         Composing sense (social / intellectual orientation (or mood) of the text)

 

Again, this parallel presentation of a same object (encountered in so many data modeling problematics) is one of the important analogies with molecular biology elements (i.e. similar, for example, to nucleotide sequences mapping to amino acids).

To illustrate another aspect of this analogy, let us take a look at the characters / words ó characters / phonemes parallel. To correctly read a phoneme, we need to locate its start-end characters. Which may overlap or be part of the ‘Words’ sequence of our text. In some way, we need to retrieve the reading frame (or phasing) of a sequence of phonemes through our nucleotidic characters structure. This phasing is independent of the characters/words sequence presentation. Which, again, brings to our mind the question of reading frames of an amino acid sequence contained in a nucleotidic sequence.

 

In the case of our text sequence question, characters, words, phonemes… etc. are, of course, language-dependent. However, for sake of simplicity, let us stay in the context of the English language.

 

Let us now take an example of how we can read a ‘mood’ sequence inside a physical text sequence (characters, words…) sequence.

The mood (social sense) of a text can be detected through the interpretation (or translation) of specific (predefined) expressions sequence(s).

For example:

“That’s great” can be interpreted differently from “hey… fantastic”

Or “Hello”, differently from “Hi”…

Or “L” differently from “J

… etc.

 

Social expression of a text sequence is also, in some way, related to its internal phoneme sequence. Text phonemes actually produce a sequence of sounds that give a particular internal ‘music’ to the text. Which participates, in the end, in transmitting the specific social sense of the initial text sequence. That is probably an important aspect of poetry (?)

 

I will provide a practical coded example in a future post.

JAN 25… "Those stone-age men setting in chairs"

Egypt’s January 25 revolution is a great hope for humanity.

Against a regime of criminals with 1.8 million of “well-equipped” and “well-trained” anti-riot forces… and some more thugs, opportunists and other hypocrites… young peaceful people with human values could win.

We are living a new dawn for human values.

Happy new year, Stephane Hessel

A new year is here… and this reminds me of Stephane Hessel, a young man born in 1917.

After having fought against the Nazis in World War II, he still keeps teaching us so many (simple) principles of humanity... still offers us a fresh and critique view of the True and False wellbeing of our ‘modern model’ of civilization… inviting us to prefer human values against established laws, and to keep our indignation in front of ‘financial market dictatorship’. (Read this interview)

 

Happy New Year Stephane Hessel… we will try harder!

 

Pour nos amis francophones :

·         Stéphane Hessel sur Wikipédia FR…

·         Lire la présentation de son livre ‘Indignez-vous’ !

Political pause: Challenges à la Française

Dans un des derniers numéros, Fortune prend comme sujet « 40 under 40 » pour parler de 40 (ça nous change des chiffres 50 et 500 J) jeunes personnalités.

Parmi ces 40 personnalités, on trouve Esther Duflo, économiste d’origine française, actuellement professeur au Massachusetts Institute of Technology (MIT) où elle détient la « chaire Abdul Latif Jameel sur la réduction de la pauvreté et l'économie du développement ».

Cela m’a fait plaisir de savoir que la France avait encore à donner au monde quelque chose de différent à la fois de Sarkozy et de BHL !

Quelques semaines plus tard, c’est dans le magazine français Challenges que je suis tombé sur ce gentil commentaire à propos du même sujet :

« … cette sélection des "40 under 40" très ouverte aux non-Américains. Mais quel Français parmi ces 40 visages ? L’économiste Esther Duflo, professeur au MIT, experte de la mesure de l’efficacité des programmes anti pauvreté. Comme si la France avait fait de la misère son domaine de compétence… »

 

Très aimable !

 

Bizarrement, le numéro suivant de ce même magazine, consacre des pages et des pages à un autre genre de under 40 : Pierre Kosciusko-Morizet.

Né en 1977, ce jeune homme a apparemment fait un gros coup qui vaut le détour : créer une boîte (française donc : priceminister) pour la revendre dernièrement (pour pas mal d’argent… c’est le sens du succès) à une boîte Japonaise…

Là apparemment on n’est pas dans la misère (selon à travers de quel trou on regarde la scène !)

 

Learning from Nature: Towards a 'Nucleotidic' modeling - part I

 

 

 

During several years, I worked on a DNA sequence-analysis software project where I learned about DNA structures and several DNA engineering techniques.

(That is not to be confused with what is commonly called ‘genetic algorithms’ and ‘genetic programming’).

 

Elements and structures used (and manipulated) in molecular biology engineering sphere are fascinating and, above all, source of interesting knowledge. In some way, they define the representation of ‘Life hood’ structures and mechanisms for every living creature (plant, animal, bacteria, virus…)

Molecular biology teaches us that ‘Life’ is based on few nucleotides: A, T, G and C.

Like in music partitions, sequences composed of these few number of nucleotides can give unlimited number of combinations each representing the structure of a specific biological function and, in the end, a specific individual being.

 

Here are some sample (random) fragments of DNA sequences:

 

3’à…GCAATGGTTTCTTACTGTGGAGGACATAAAAATACAGCAAGGGT…à5’

3’à…TTGTGTTGCGAGATGTCGTCGTTAAAGACACTCTTTCTCCCGGAGTCAC…à5’

3’à…CTCTACAGTATAAAGTTCTAGTAAGAGCACAAACTCCTGGACAATTC…à5’

 

Note that DNA sequences are read in a specified direction (noted 3’à5’ in the above sequences).

Nucleotides are considered in complementary (attracted) pairs. A is complementary to T, and G to C.

Each DNA sequence strand has a ‘complementary’ sequence strand where complementary nucleotide pairs are arranged face-to-face in reversed direction to compose part of the well-known helicoidal presentation.

 

Example:

The complementary strand for

3’à…GCAATGGTTTCTTà5’

Is

5’ß…CGTTACCAAAGAAß3’

 

A DNA sequence has its mapped amino acid (protein) sequence. In this mapping, different combinations of three nucleotides (A, T, G or C) compose codons, each mapped to one amino acid (one amino acid may have several codon mappings… see below).

Here are some codon/amino acid mappings:

 

Amino acid

Amino acid Symbol

Codon

Alanine

A

GCA

GCC

GCG

GCT

Arginine

R

AGA

AGG

CGA

CGC

CGG

CGT

Asparagine

N

AAC

AAT

Methionine

M

ATG

 

A sequence may have several “reading frames” in which amino acid codons mapping interpretation may vary. Essentially, to read a sequence, you must first find a starting codon… otherwise; your sequence is the representation of nothing in biological life (real world!)

 

Another interesting aspect is that a specific DNA sequence (with ‘significant’ length) seems to represent one part of a global ‘predefined’ structure… that is, in a way, similar to a known melody in music. If you start to play the first specific notes of, say, a Beatles’ song, everyone can tell the rest of the melody. If your first notes are not specific enough, the result may lead to so many different melodies.

This phenomenon is used in PCR (Polymerase Chain Reaction) in molecular biology engineering to amplify or clone DNA sequences using partial sequences (rigorously selected!).        

 

Useful lessons for software design

Many (if not all J) real world problems seem to follow DNA sequences structure and representations:

§  Basic elements (A, T, G, C)

§  Related each to one another (AT, GC)

§  Composing a global sequence (unique for a specific area)

§  The sequence can be presented differently (DNA /Amino acid)

§  The translation between representations is done through specific mappings (codons / amino acids)

 

PCR technique also seems of great interest to some software areas (OCR recognition for example)

 

I will continue, in future posts, to explore these fascinating structures and propose some applications that mimic and benefit from their behaviors.

 

Back to basics: the Team vs. the Crew!

“If you don’t vent the drain pipe like this, sewage gases will seep-up through the water in the toilet, and the house will stink of shit”!

That seems to be a ‘clear standard’ taught to an apprentice.

Around such clear, understandable and concrete reasoning, you can build a product (or at least a knowledge) that is reusable and sustainable.

In his book “Shop Class As Soul Craft”, Matthew B. Crawford revisits the meaning, structure and alienation of Work and Knowledge in the modern era (particularly after World War II) and delivers a fresh and inspired view of the question.

One of the discussed subjects is the ‘Team’ rhetoric which appears to be the modern form for trying to definitively remove the individual from the image of ‘Work’.

 

“There is a sort of friendship or solidarity that becomes possible at work when people are open about differences of rank, and [where] there are clear standards.”

 

Throw, but only ‘exceptional’ exceptions!

I find the Try/Catch mechanism fascinating! This is probably due to some events I lived in the (not so far) History! (see below)

The thing is, when I see any of its related keywords: try, catch, finally and, specially, throw… I feel some kind of nervousness or unease!

Unfortunately, for me, more and more source code tries, catches and throws exceptions. It seems sometimes easier to throw an exception while simply an object ‘status’ would be required.

Some history

I remember an intriguing piece of code (2 or 3 C language macros) that was one of the first research I encountered about implementing a dynamic error capturing (now called ‘exception handling’). I kept this code for years (in my ‘code-museum’!) but ended up by losing it through the long journey of OS, compilers and IDEs changes!

Fortunately, I found someone (Francesco Nidito) who still (beautifully) talks about this nearly same macros (you can have a more detailed look here). His article is exactly about the solution that I first saw in the 80s, with some interesting additions (mixed with a good dose of humorJ).

 

If you used C language before, you know the impact (and importance) of ‘preprocessing’. This is the step where the compiler expands the expressions before going further in the compilation process.

For example, if you define a macro:

 

#define SAY_HELLO   int    x;\

                    for( x = 0; x < 10; x++)\

                           printf(“Hello!”);

 

In the preprocessing step, the compiler will replace each SAY_HELLO occurrence by the lines of code above.

 

longjmp And setjmp

Before diving in the historical macros, to better understand their work, we should first have a look at those two (strange) C language functions: longjmp and setjmp (declared in setjmp.h header file):

 

int setjmp(jmp_buf env);

void longjmp(jmp_buf env, int val);

 

The documentation says:

 

The setjmp function saves a stack environment, which you can subsequently restore, using longjmp. When used together, setjmp and longjmp provide a way to execute a non-local goto. They are typically used to pass execution control to error-handling or recovery code in a previously called routine without using the normal calling or return conventions.

A call to setjmp saves the current stack environment in env. A subsequent call to longjmp restores the saved environment and returns control to the point just after the corresponding setjmp call. All variables (except register variables) accessible to the routine receiving control contain the values they had when longjmp was called.

It is not possible to use setjmp to jump from native to managed code.

Note   setjmp and longjmp do not support C++ object semantics. In C++ programs, use the C++ exception-handling mechanism.

The basic Try/Catch macros

Using the magic that can be done by setjmp and longjmp, the following bizarre macros are the basis of a try/catch mechanism:

 

#define TRY            do{ jmp_buf ex_buf__; if( !setjmp(ex_buf__) ){

#define CATCH          } else {

#define ETRY           } }     while(0)

#define THROW          longjmp(ex_buf__, 1)

 

So, now you may write

 

TRY

{

       DoSomething(“with this string”);

}

CATCH

{

       printf(“some error happened!”);

}

ETRY         /* end of try/catch! */

 

At compile-time, this would be expanded to the following code:

 

do{ jmp_buf ex_buf__; if( !setjmp(ex_buf__) ){

{

       DoSomething(“with this string”);

}

} else {

{

       printf(“some error happened!”);

}

} }   while(0)           /* end of try/catch! */

 

 

What does it mean?

Let’s try to read the macros meaning:

TRY, ends with an ETRY. That is do{ xxxx } while(0) (which means: do xxxx only ONCE)

TRY starts by saving the current caller’s stack into a ‘jmp_buf’ variable. If saving the current caller stack succeeds, the next instructions (code block of ‘try’) are executed. Otherwise, the catch block instructions are executed instead.

THROW executes a non-local GOTO (by calling longjmp) which returns execution to the previous caller of the stack saved into the jmp_buf with a return value of 1 (of course, longjmp can be called with a different return value).

 

Anything new?

Of course, our C++, C# and VB Try/Catch mechanism is a little more elaborate than the one exposed here. The foundations remain the same. And, in fact, nothing had fundamentally changed in this area since: any try/catch block executes, at least, this fearful acrobatic setjmp / longjmp.

 

It may be useful to remember this before writing your next try/catch block!

 

Windows Vista / Windows 7: To pin or not to pin, that is…

Have you ever tried, in Windows Vista or 7, to pin to the start menu (or to the task bar), an item whose name contains ‘documentation’?

Well, that is simply impossible (and, above all, forbidden!)

(You may have a look at this discussion… hope the link will still be aliveJ)

 

Why?... and Who decided this?

 

Why?

In Windows Vista or 7, you cannot pin to the start menu (nor to the task bar), any item whose name contains one of the following words (quite long list... long list J):

·         Documentation

·         Help

·         Install

·         More Info

·         Read me

·         Read First

·         Readme

·         Remove

·         Setup

·         Support

·         What's New

 

Note that this doesn’t still tell us any useful information about WHY are these words excluded from ‘pinnable’ items. And what logic is behind this choice?!

Nobody and no literature want to explain something plausible about this mysterious choice.

 

Still you can do It!

Curiously enough, you can still pin an item whose name contains one of these blasphemed words. Without even going to the famous ‘Registry’, just try the following:

·         Rename your item to be pinned (example: remove just one character of ‘documentation’ to obtain something like ‘documentatio’);

·         You can now pin your item to whatever you want;

·         Rename again the item to its original name;

·         Rename the pinned item to the name you like.

 

Who?

As for ‘Who’ decided and designed this genius (customs-office-attitude-like) feature?... It seems that those are the same Microsoft’s young people playing with Windows Interface, under the name of “Application User Model ID” to deliver us some awesome features (like sub folders hysterically bouncing down when you expand them: see this post).

They, apparently, continue to care about us in Windows 7

God bless them all… hope they will still be there in Windows 8.

 

Is it a shame?

As you may have noticed, the link to http://support.microsoft.com/kb/282066... The page where this design is confirmed doesn’t exist anymore!

 

Sorting dates: Ascending, Descending OR…

This is a small story, yet with something special:

Once upon a time, there was a list of events stored into a database table. Each event had (evidenceJ) a date.

A friend of mine asked me to sort these event items.

I asked, as you may imagine: Ascending or Descending?

 

But this, apparently, seemed too simplistic for him…

- I want the most recent to appear first. He said.

- Well, that means you want to sort in descending order.

I gave him a demo of data sorted in descending order…

- No, he said, that is not what I want!

 

After a short discussion, I understood that what he wanted was:

·         To first have the incoming events (i.e. those located after “today’s” date… sorted in an ascending order)

·         Followed by older dates (sorted in ascending order)

 

I first thought: can ORDER BY do something else than sorting in ascending / descending?...

As the answer was, evidently, No… I said: Sorry, but that is not possible!

The question remained in my mind however. And I started looking for a solution (for myself!)

The experimentations didn’t in fact last long, the solution was quickly found:

 

All what we need is to:

§  Categorize dates according to their location relative to Today (or any other logic);

§  Give each category a ‘sortable’ value (integer for example)

§  Sort by the category’s value, followed by the date value.

 

Example:

SELECT TOP (100) PERCENT

      event_date,

      description,

      CASE WHEN event_date >= getutcdate() THEN 1

            ELSE 2

      END               AS date_category  -- categorize date

FROM         dbo.sight_conferences

ORDER BY date_category, event_date

 

 

Screenshot of the output data sample

 

 

 

The key part of this code is the logic of categorizing dates. In this sample, categorization was quite simple (set a category according to date location relative to Today). But, of course, we can use another logic scheme to obtain data sorted accordingly.